Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.127558 |
Chromosome: | chromosome 13 |
Location: | 5166113 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g607750 | CCDC65,DRC2,FAP250 | Nexin-dynein regulatory complex 2; (1 of 1) PTHR21625:SF0 - COILED-COIL DOMAIN-CONTAINING PROTEIN 65 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCAGTTGGTCACAAAGTTAGCCTTCGTTA |
Internal bar code: | CTCCCCTCGCACACAGCGATTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 627 |
LEAP-Seq percent confirming: | 99.6711 |
LEAP-Seq n confirming: | 2121 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGTGCCTATCTAGCAGTCGC |
Suggested primer 2: | TTATCGCTCATCCTCATCCC |