| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.127565 |
| Chromosome: | chromosome 9 |
| Location: | 7598127 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g414650 | (1 of 18) K08824 - cyclin-dependent kinase-like [EC:2.7.11.22] (CDKL) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGGCTCATTCGGTATGCCATCCCGGCATA |
| Internal bar code: | CCGGCTCCGGTCGCGAAAGGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 221 |
| LEAP-Seq percent confirming: | 57.359 |
| LEAP-Seq n confirming: | 834 |
| LEAP-Seq n nonconfirming: | 620 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCAACCTCAGATTTGCTTG |
| Suggested primer 2: | TCTGACGCTCCAACTGAATG |