Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.127706 |
Chromosome: | chromosome 17 |
Location: | 765238 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g701500 | DNJ1 | (1 of 1) K09503 - DnaJ homolog subfamily A member 2 (DNAJA2); DnaJ-like protein | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCCTAGCTGCCTCCATGGCTTCCCACAGT |
Internal bar code: | CAACGGAATTAGGCAGGCATAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 808 |
LEAP-Seq percent confirming: | 97.9839 |
LEAP-Seq n confirming: | 1944 |
LEAP-Seq n nonconfirming: | 40 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GACAATGACGAGCTTGACGA |
Suggested primer 2: | TAGTCAAGGGGTCAACAGGG |