Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.127751 |
Chromosome: | chromosome 10 |
Location: | 6307800 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g465250 | PF25,RSP11 | (1 of 2) PF02197 - Regulatory subunit of type II PKA R-subunit (RIIa); Radial Spoke Protein 11 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTCGGGGTCCATGTCGGGGCCCAGGTGCG |
Internal bar code: | GCACCTTGACGTCCGAGGAATT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 117 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 11 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCAACGGACCTCATAGCATT |
Suggested primer 2: | CAAGCCCACAATCCGTAGTT |