Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.127781 |
Chromosome: | chromosome 10 |
Location: | 1618718 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g429601 | (1 of 2) PTHR10060:SF22 - CELL DEATH-RELATED NUCLEASE 2 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAATCAGCCTTTCGCTCAGAGCATGCAGC |
Internal bar code: | CAAAGGCCCAGTGCGAGATTGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 756 |
LEAP-Seq percent confirming: | 95.5988 |
LEAP-Seq n confirming: | 3584 |
LEAP-Seq n nonconfirming: | 165 |
LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGACGAGCACTATCACTCCG |
Suggested primer 2: | AAACCAACCCCAATGCAATA |