| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.127800 |
| Chromosome: | chromosome 12 |
| Location: | 90258 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g483900 | (1 of 3) 3.6.3.2 - Magnesium-importing ATPase / Mg(2+)-importing ATPase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGAGCGACTCTGTCACTGCTTACACCAGCA |
| Internal bar code: | GCGCGGCACCGGGGGCGGAGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 440 |
| LEAP-Seq percent confirming: | 97.1793 |
| LEAP-Seq n confirming: | 6546 |
| LEAP-Seq n nonconfirming: | 190 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTACTAGAACGGTTGCCCA |
| Suggested primer 2: | TACACGCTGACCGTTTCTTG |