| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.127847 |
| Chromosome: | chromosome 5 |
| Location: | 3145189 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g239300 | (1 of 85) IPR009057 - Homeodomain-like | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCTGTGGGGGAGGATGATGGAGGCTATTA |
| Internal bar code: | CCGTGCTCGCCTCGCCAGGCCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 934 |
| LEAP-Seq percent confirming: | 99.7333 |
| LEAP-Seq n confirming: | 3740 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGGGCAGAGCAGAGTTAGT |
| Suggested primer 2: | ACCACCTTGGAACACTTTGC |