Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.128045 |
Chromosome: | chromosome 9 |
Location: | 3541916 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g389912 | (1 of 1) K14018 - phospholipase A-2-activating protein (PLAA, DOA1, UFD3) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTTCATGGTAGTGGAAGCAGGCCGGGACC |
Internal bar code: | CGAAGGACTCGGGGGCTTACTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 624 |
LEAP-Seq percent confirming: | 98.6687 |
LEAP-Seq n confirming: | 1927 |
LEAP-Seq n nonconfirming: | 26 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGTAACGCACGTTTTCCCT |
Suggested primer 2: | CACAATCTGTGTTGGGGTTG |