| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.128115 |
| Chromosome: | chromosome 9 |
| Location: | 2067295 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g394050 | CPLD19 | Zinc finger family protein; (1 of 1) PTHR22883:SF91 - PROTEIN S-ACYLTRANSFERASE 12-RELATED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCACCCTCCTTCCCCCCCACCTGCCCCCA |
| Internal bar code: | TAGAAAAATGAATTGCGTACTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 824 |
| LEAP-Seq percent confirming: | 58.8193 |
| LEAP-Seq n confirming: | 827 |
| LEAP-Seq n nonconfirming: | 579 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGGGGGAGTTAAGAGGGAG |
| Suggested primer 2: | ACTGTTACGGTGATCCTGGC |