Insertion junction: LMJ.RY0402.128134_2

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.128134
Chromosome:chromosome_8
Location:4151537
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre08.g379900 antisense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):GGCGCTGGCGGCGGGGAGCATATCCTCAGA
Internal bar code:GGCGAGGGCATCTGACTTTAGA

Confirmation - LEAP-Seq

LEAP-Seq distance:590
LEAP-Seq percent confirming:95.2564
LEAP-Seq n confirming:743
LEAP-Seq n nonconfirming:37
LEAP-Seq n unique pos:13

Suggested primers for confirmation by PCR

Suggested primer 1:TTTTCCTGTGCTTTCCTGCT
Suggested primer 2:TTGTAACGACAGCTTGCGAC