| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.128160 |
| Chromosome: | chromosome 17 |
| Location: | 4380346 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g731500 | FAP394 | Flagellar Associated Protein 394; (1 of 1) IPR000157//IPR011050 - Toll/interleukin-1 receptor homology (TIR) domain // Pectin lyase fold/virulence factor | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTACGGCAGGCCGGGGCGCGCGCCTCAAG |
| Internal bar code: | CGTTAACGACGGCCAGGTATAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 672 |
| LEAP-Seq percent confirming: | 97.3447 |
| LEAP-Seq n confirming: | 8102 |
| LEAP-Seq n nonconfirming: | 221 |
| LEAP-Seq n unique pos: | 44 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCTCTCCTGTTGCTTTCTG |
| Suggested primer 2: | GAGTGGAGGTGAGCCTTCAG |