| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.128221 |
| Chromosome: | chromosome 1 |
| Location: | 4563062 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g031100 | MET1,TEF30 | Thylakoid enriched fraction, 30-kDa protein; (1 of 3) PTHR17130//PTHR17130:SF24 - MITOCHONDRIAL OUTER MEMBRANE PROTEIN 25 // GAN | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGGCTTGGGCAGGTCCAGCTGCAAGTAAC |
| Internal bar code: | ATCGGCGTAAAACTTGGGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 86 |
| LEAP-Seq percent confirming: | 93.6 |
| LEAP-Seq n confirming: | 117 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTGCCCTGTCCTTCAGTAG |
| Suggested primer 2: | CGATGCAATAAAATGATGCG |