| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.128318 |
| Chromosome: | chromosome 10 |
| Location: | 847511 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g423650 | PRPL11 | Chloroplast ribosomal protein L11; (1 of 1) PTHR11661//PTHR11661:SF7 - 60S RIBOSOMAL PROTEIN L12 // 50S RIBOSOMAL PROTEIN L11, CHLOROPLASTIC-RELATED | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATCAACACTTGGTGGGCCACTGTCCCGGG |
| Internal bar code: | GATCGGCAGGGACGCCAGGTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 410 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 1168 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTGGAGTCTGGGTGACTGT |
| Suggested primer 2: | CGAGCACCCCTCTGAGTTAG |