| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.128355 |
| Chromosome: | chromosome 8 |
| Location: | 4827793 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g384390 | POLQ2 | DNA polymerase theta; (1 of 2) K02349 - DNA polymerase theta [EC:2.7.7.7] (POLQ) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTGCTGGCGCGTGCGGCGGCGGCGCGGGA |
| Internal bar code: | TACATCCGCAAAGTCCAGTGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 215 |
| LEAP-Seq percent confirming: | 53.9073 |
| LEAP-Seq n confirming: | 407 |
| LEAP-Seq n nonconfirming: | 348 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTTGCATTGCTGTGCTGAT |
| Suggested primer 2: | AGGTGGAAGGAGCGACCT |