| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.128392 |
| Chromosome: | chromosome 3 |
| Location: | 3351746 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g166600 | DIV147 | (1 of 1) PTHR13366//PTHR13366:SF0 - MALARIA ANTIGEN-RELATED // HEAT REPEAT-CONTAINING PROTEIN 6 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCGGCCACAGCTCCCCTACCGAACACGAA |
| Internal bar code: | AGGCGGGATTTCAAACGGGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 745 |
| LEAP-Seq percent confirming: | 98.4348 |
| LEAP-Seq n confirming: | 566 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGTAGCAAGAAGGGACAAG |
| Suggested primer 2: | GACAAGGCTGACCTTCTTGC |