Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.128560 |
Chromosome: | chromosome 13 |
Location: | 2341518 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g579200 | S6K1 | (1 of 1) K04688 - p70 ribosomal S6 kinase (RPS6KB); Ribosomal protein S6 kinase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTACACACACAGCTCCCCCGATTGACATT |
Internal bar code: | CTCACGCTCAAGCATTACCACG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 425 |
LEAP-Seq percent confirming: | 96.3801 |
LEAP-Seq n confirming: | 213 |
LEAP-Seq n nonconfirming: | 8 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGCCATGGAAATGGTGATAC |
Suggested primer 2: | GAGGCCGTAAACAACCGTAA |