Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.128627 |
Chromosome: | chromosome 6 |
Location: | 2059357 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g264850 | (1 of 1) PTHR33820//PTHR33820:SF2 - FAMILY NOT NAMED // COILED-COIL DOMAIN-CONTAINING PROTEIN 17 | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATACTGTAGGCCACCAACGCACCATCCACA |
Internal bar code: | CGGCCTGTACCGCGATGGAACA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 799 |
LEAP-Seq percent confirming: | 99.5475 |
LEAP-Seq n confirming: | 2640 |
LEAP-Seq n nonconfirming: | 12 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCAGAGGCTGGACCTTGTCT |
Suggested primer 2: | GTCAGCTGCCGTACCTTCTC |