| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.128637 |
| Chromosome: | chromosome 3 |
| Location: | 7321203 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g206750 | (1 of 1) IPR016040//IPR025659 - NAD(P)-binding domain // Tubby C-terminal-like domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCAGCCTAAACCAAACCGAACCTGAGAAT |
| Internal bar code: | CGGGACGGAGATGGACGCCCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 836 |
| LEAP-Seq percent confirming: | 99.6158 |
| LEAP-Seq n confirming: | 1037 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACACACACACACACACCG |
| Suggested primer 2: | GGGAAAGAACAAGGGAAAGC |