| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.128666 |
| Chromosome: | chromosome 9 |
| Location: | 4123325 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g393691 | KDG4 | (1 of 1) 2.7.1.138 - Ceramide kinase / Acylsphingosine kinase; Diacylglycerol/ceramide/sphingosine kinase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGCCCCCTTGAACCTGGCAATAGCTCAAC |
| Internal bar code: | TTAAAAGCACAGCGTCCTGCAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 523 |
| LEAP-Seq percent confirming: | 99.8299 |
| LEAP-Seq n confirming: | 587 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTTCCTTCAACCCCTACCC |
| Suggested primer 2: | CTCGTGTACGTGAACCCCTT |