| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.128690 |
| Chromosome: | chromosome 17 |
| Location: | 6697325 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g744147 | (1 of 1) K12854 - pre-mRNA-splicing helicase BRR2 (SNRNP200, BRR2) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGTCATGAATGTCAACCCCCACAGGCGAG |
| Internal bar code: | GCTAATTTCACGGAGAGTCCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 507 |
| LEAP-Seq percent confirming: | 97.4826 |
| LEAP-Seq n confirming: | 1123 |
| LEAP-Seq n nonconfirming: | 29 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGTAGCCTGAAGAGACGCC |
| Suggested primer 2: | TCAATGCAATGGTTGACGTT |