| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.128709 |
| Chromosome: | chromosome 3 |
| Location: | 83295 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g143827 | FBB7 | Flagellar/basal body protein 7; (1 of 1) IPR001680//IPR011047//IPR011048//IPR017986 - WD40 repeat // Quinonprotein alcohol dehydrogenase-like superfamily // Cytochrome cd1-nitrite reductase-like, haem d1 domain // WD40-repeat-containing domain | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTTCGAGGGCCGACCTAGTGAAGTACCAT |
| Internal bar code: | ACGGGGTGGAGGTCCAGCCGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 801 |
| LEAP-Seq percent confirming: | 97.2222 |
| LEAP-Seq n confirming: | 175 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACAGAAGCGCAGGAATGTA |
| Suggested primer 2: | CGCACCTCCTGAGATATGGT |