Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.128795 |
Chromosome: | chromosome 6 |
Location: | 7980219 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g303800 | (1 of 29) PF00612 - IQ calmodulin-binding motif (IQ) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATAATACAAGCCCCAATCCAGCCCAACCTT |
Internal bar code: | CCGAGGTAGCCATGACATCCGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 504 |
LEAP-Seq percent confirming: | 83.2343 |
LEAP-Seq n confirming: | 9666 |
LEAP-Seq n nonconfirming: | 1947 |
LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CACTGTACACCGGTACGACG |
Suggested primer 2: | TCCCCGACCTCTCTTACCTT |