Insertion junction: LMJ.RY0402.128824_2

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.128824
Chromosome:chromosome_3
Location:3739480
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre03.g169750 antisense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):CAGCGCTCCGCCTCAATAACGCGGTCGCCG
Internal bar code:GTACCAAAATACAAGCAAGCCA

Confirmation - LEAP-Seq

LEAP-Seq distance:699
LEAP-Seq percent confirming:99.8954
LEAP-Seq n confirming:955
LEAP-Seq n nonconfirming:1
LEAP-Seq n unique pos:7

Suggested primers for confirmation by PCR

Suggested primer 1:GGGATTGTAGGAGCCTGTGA
Suggested primer 2:AAGTCCCATCATCAAGTGGC