| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.128926 |
| Chromosome: | chromosome 13 |
| Location: | 1634832 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g573650 | SRS8,SRS5 | Serine/arginine-rich pre-mRNA splicing factor; (1 of 89) PF00076 - RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) (RRM_1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACGGACGCCAGTTTAAACAAGCATTGGGG |
| Internal bar code: | CCGGAGATGTTTGAATGGCAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 814 |
| LEAP-Seq percent confirming: | 97.6364 |
| LEAP-Seq n confirming: | 2148 |
| LEAP-Seq n nonconfirming: | 52 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGCTTTGACTCGATCACCA |
| Suggested primer 2: | CAGAATCGCGAAATGACTGA |