| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.128960 |
| Chromosome: | chromosome 7 |
| Location: | 3908067 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g339104 | (1 of 2) 3.6.3.19 - Maltose-transporting ATPase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCGCAATGTATACCCCGTCGCGGGGCGAT |
| Internal bar code: | GCGGTGCCGTTCTTTCGCCTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 638 |
| LEAP-Seq percent confirming: | 87.9167 |
| LEAP-Seq n confirming: | 2743 |
| LEAP-Seq n nonconfirming: | 377 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGATAGAGGAGGAAGGGCAC |
| Suggested primer 2: | AGCTGTTGTGACCTACGCCT |