| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.129037 |
| Chromosome: | chromosome 7 |
| Location: | 3942450 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g339350 | (1 of 1) K14050 - geranylgeranyl transferase type-2 subunit alpha [EC:2.5.1.60] (RABGGTA) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCATGCTACATGTAAGACCATGAGTTATC |
| Internal bar code: | ACCCGGCTGTGGGACGAGGGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 869 |
| LEAP-Seq percent confirming: | 98.7321 |
| LEAP-Seq n confirming: | 3037 |
| LEAP-Seq n nonconfirming: | 39 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATTCCCAACTGCTCCTGATG |
| Suggested primer 2: | GACGTCGGTATCGGTGCTAT |