Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.129149 |
Chromosome: | chromosome 2 |
Location: | 749043 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g078550 | FAP210 | (1 of 5) PF13868 - Trichohyalin-plectin-homology domain (TPH); Flagellar Associated Protein 210 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATGCAACGGGAAGAGGTGGCGTGCGTTTG |
Internal bar code: | GACGACCACGCAGTGCGATATT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 663 |
LEAP-Seq percent confirming: | 99.7677 |
LEAP-Seq n confirming: | 5584 |
LEAP-Seq n nonconfirming: | 13 |
LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AACCCTCTCCCGACTCCTTA |
Suggested primer 2: | AGCTTCTCCTCGTCCTCCTC |