Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.129157 |
Chromosome: | chromosome 9 |
Location: | 575203 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g403750 | HAD6 | Halo-acid dehalogenase-like hydrolase; (1 of 1) PTHR12725:SF55 - F14L17.7 PROTEIN | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGTTGCAGTCGCCTTGCTTTCTGCATTGG |
Internal bar code: | GAGGAGGAGACAGTGTTTGCGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 861 |
LEAP-Seq percent confirming: | 99.9184 |
LEAP-Seq n confirming: | 1225 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCACCACTCCCAGTACCAGT |
Suggested primer 2: | GCCCACCAGCAACTGTATCT |