| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.129170 |
| Chromosome: | scaffold 18 |
| Location: | 96295 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre18.g748697 | (1 of 2) PTHR31362//PTHR31362:SF0 - FAMILY NOT NAMED // PROTEIN E03H4.4-RELATED | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGACGGCCCGGAGGGCGTCCAGGTGGGTG |
| Internal bar code: | CGCGGCTACGGCAATGGACCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 847 |
| LEAP-Seq percent confirming: | 99.8731 |
| LEAP-Seq n confirming: | 4722 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATAACAACGATTAACGCCGC |
| Suggested primer 2: | GCTTCTCACCAAAACGGGTA |