| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.129244 |
| Chromosome: | chromosome 1 |
| Location: | 2934182 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g017900 | (1 of 8) IPR011047//IPR018391 - Quinonprotein alcohol dehydrogenase-like superfamily // Pyrrolo-quinoline quinone beta-propeller repeat | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGGCATACGTGCCGCCCGCCCGCTGCAGG |
| Internal bar code: | CGGGATTAGCTGCCTTCTGTCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 106 |
| LEAP-Seq percent confirming: | 99.2792 |
| LEAP-Seq n confirming: | 1515 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCCGCTGACTTCTTCGTTT |
| Suggested primer 2: | GGGTGCAGCAATACTTTGGT |