Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.129430 |
Chromosome: | chromosome 3 |
Location: | 4606811 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g177053 | (1 of 2) K17263 - cullin-associated NEDD8-dissociated protein 1 (CAND1) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTTTTGCCTGACCCACATCGCCTCCTCGC |
Internal bar code: | GGGGCACGAAGATGGGAAGGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 406 |
LEAP-Seq percent confirming: | 47.8715 |
LEAP-Seq n confirming: | 3846 |
LEAP-Seq n nonconfirming: | 4188 |
LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACTTCATCAACGCAACTCCC |
Suggested primer 2: | ATCCCCTAAACCCCAGTTTG |