| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.129456 |
| Chromosome: | chromosome 4 |
| Location: | 3212854 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g226450 | PRP17 | (1 of 1) K12816 - pre-mRNA-processing factor 17 (CDC40, PRP17); Nuclear pre-mRNA splicing factor, component of the spliceosome | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGCTGGAACCAGGGGAGTGGCAAAGGCG |
| Internal bar code: | GCGGCCGGCGGGGCCGGTAAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 736 |
| LEAP-Seq percent confirming: | 91.0394 |
| LEAP-Seq n confirming: | 4318 |
| LEAP-Seq n nonconfirming: | 425 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGACTAGGAGGGTGAAAGG |
| Suggested primer 2: | TTTCTGTTTGGTCCCTGGAG |