Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.129484 |
Chromosome: | chromosome 2 |
Location: | 4342678 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g099300 | ANK21 | (1 of 15) PF13857 - Ankyrin repeats (many copies) (Ank_5); Predicted protein with ankyrin repeats | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGATGAGAGCCAGGCTCGTTAGTAGTTTG |
Internal bar code: | CTTAGCGCCCTACAGGCACTGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 668 |
LEAP-Seq percent confirming: | 98.8444 |
LEAP-Seq n confirming: | 1112 |
LEAP-Seq n nonconfirming: | 13 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAGCGGTGTGATACCATCAG |
Suggested primer 2: | AACCGTCACAATGGAAGAGG |