| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.129512 |
| Chromosome: | chromosome 8 |
| Location: | 3639067 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g376350 | ASF1 | Anti-silencing factor; (1 of 1) K10753 - histone chaperone ASF1 (ASF1) | 5'UTR|outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAACCAGGTCTATGATTTCGCAGCTTACG |
| Internal bar code: | CGGTCTTTTCACATGTCATGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 402 |
| LEAP-Seq percent confirming: | 99.7108 |
| LEAP-Seq n confirming: | 11033 |
| LEAP-Seq n nonconfirming: | 32 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGACTAGGATTTGCCAGAGC |
| Suggested primer 2: | CGGTAAGAGCAGGTGAGGAG |