| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.129571 |
| Chromosome: | chromosome 9 |
| Location: | 4204609 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g394251 | PF16 | Central pair associated protein; (1 of 1) PF00514//PF13513 - Armadillo/beta-catenin-like repeat (Arm) // HEAT-like repeat (HEAT_EZ) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTCTGATGTAAAATACTCAAGTGAACAGA |
| Internal bar code: | CGTTGTGCTCCTACGCGGAACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 797 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 296 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GATGTGTCAGCGACGAAAGA |
| Suggested primer 2: | ACAACTCGAAGTGGTTTGGG |