Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.129579 |
Chromosome: | chromosome 11 |
Location: | 3673163 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g482550 | (1 of 34) IPR003072 - Orphan nuclear receptor, NOR1 type | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCACTCCGTGCCCGATGCTCCTGCCGTGCT |
Internal bar code: | TATTGCCTCCCCGTGCGGCGGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 439 |
LEAP-Seq percent confirming: | 96.806 |
LEAP-Seq n confirming: | 2061 |
LEAP-Seq n nonconfirming: | 68 |
LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGCCACGTACTGTATGGTTG |
Suggested primer 2: | TTATTTTCCCATCCAATCGC |