Insertion junction: LMJ.RY0402.129854_2

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.129854
Chromosome:chromosome_17
Location:5461847
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre17.g737200 sense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):TGACACGCTCGCTACCTCGGTTGCGCATTA
Internal bar code:AGAACGGTGGGTATGACCGGGA

Confirmation - LEAP-Seq

LEAP-Seq distance:834
LEAP-Seq percent confirming:99.7352
LEAP-Seq n confirming:1130
LEAP-Seq n nonconfirming:3
LEAP-Seq n unique pos:10

Suggested primers for confirmation by PCR

Suggested primer 1:TGTACTGCGTGCAGAAGGTC
Suggested primer 2:GTAATGGGAGCACAGTCCGT