Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.129859 |
Chromosome: | chromosome 1 |
Location: | 5496009 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g038750 | MOT7 | (1 of 1) IPR007024 - BLUF domain; motile cilia related | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCAGACGAGGGTGGTCTGCGTCGCTTTTA |
Internal bar code: | AGGTCTATCATTTGCTTGCTAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 306 |
LEAP-Seq percent confirming: | 99.7773 |
LEAP-Seq n confirming: | 448 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTGCGTAGAGAAGCCAGGAT |
Suggested primer 2: | TTGTGCGTGCTACGCTAATC |