| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.129874 |
| Chromosome: | chromosome 1 |
| Location: | 2551040 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g014800 | MSH7,CPL21 | putative MutS type 2 DNA repair protein; (1 of 1) K07456 - DNA mismatch repair protein MutS2 (mutS2) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCTTGGGGGCACCGGCGTCGCGTACACCT |
| Internal bar code: | GCCAGGCTACGGTCTGCCGGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 141 |
| LEAP-Seq percent confirming: | 15.0 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 17 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCAGTCATGGACGACATGG |
| Suggested primer 2: | CACATGCGGTGAGTGTATCC |