| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.129906 |
| Chromosome: | chromosome 7 |
| Location: | 1896994 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g325740 | PTB3 | (1 of 9) K14640 - solute carrier family 20 (sodium-dependent phosphate transporter) (SLC20A, PIT); Sodium/phosphate symporter | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTAAGTGAAACGGGTCCCAGCCCTCAGCT |
| Internal bar code: | AGTGCGTGCCGTGGCCTTTCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 845 |
| LEAP-Seq percent confirming: | 97.1004 |
| LEAP-Seq n confirming: | 1306 |
| LEAP-Seq n nonconfirming: | 39 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGGACGTAGGAGTTCTCGC |
| Suggested primer 2: | GATTCCACGGAAGAGGATGA |