| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.129927 |
| Chromosome: | chromosome 10 |
| Location: | 13802 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g417500 | CYN20E,CYN20-5,CYN9 | (1 of 1) PF00160//PF04969 - Cyclophilin type peptidyl-prolyl cis-trans isomerase/CLD (Pro_isomerase) // CS domain (CS); Cyclophilin 20-5 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGAGTCCGTTATCAGCCGCTCATGTTCCC |
| Internal bar code: | AAGTTTCGATTTGTCGGCAGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 68 |
| LEAP-Seq percent confirming: | 97.2973 |
| LEAP-Seq n confirming: | 36 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGTGGCACAGCAGATTTCG |
| Suggested primer 2: | GACTCCAACAGCTTTCCTGC |