| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.129943 |
| Chromosome: | chromosome 1 |
| Location: | 6729199 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g048350 | EBM1,CGL53 | (1 of 4) K19355 - mannan endo-1,4-beta-mannosidase (MAN); conserved protein with glycosyl hydrolase family 5 domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGGGCCACCGGCCGTGGCGAGCTCCATAC |
| Internal bar code: | GATTAAAGGCGATTTGAGAATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 282 |
| LEAP-Seq percent confirming: | 97.2973 |
| LEAP-Seq n confirming: | 1116 |
| LEAP-Seq n nonconfirming: | 31 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGGCACAGACGCTTCATAA |
| Suggested primer 2: | ATACACCTGTACCCCGACCA |