| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.129984 |
| Chromosome: | chromosome 17 |
| Location: | 3055519 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g720700 | ANK14 | Predicted protein with ankyrin repeats; (1 of 7) PF12796//PF13637 - Ankyrin repeats (3 copies) (Ank_2) // Ankyrin repeats (many copies) (Ank_4) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCTGCGTGTTGGGGTCGGCGCCGCCCTTG |
| Internal bar code: | ACACTCTGATCCATTTGGTTCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 528 |
| LEAP-Seq percent confirming: | 99.8667 |
| LEAP-Seq n confirming: | 2247 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGAGAGGAGCCAACATACA |
| Suggested primer 2: | TGAGAAGTGACGGCGTAGTG |