| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.130040 |
| Chromosome: | chromosome 3 |
| Location: | 5812781 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g189050 | EMAN,EAM1 | (1 of 1) 3.2.1.130 - Glycoprotein endo-alpha-1,2-mannosidase; Endomannosidase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTAAGAGCCTGTGCCCCCGGCCCCCTGGC |
| Internal bar code: | GATCCCAGGCCAGAGTGTCATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 397 |
| LEAP-Seq percent confirming: | 95.1028 |
| LEAP-Seq n confirming: | 5826 |
| LEAP-Seq n nonconfirming: | 300 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGCTTTGACGGCTTCTACA |
| Suggested primer 2: | CTCAGGCAGTTGCTAGACCC |