Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.130125 |
Chromosome: | chromosome 7 |
Location: | 3839686 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g338602 | POLH1 | (1 of 1) PTHR11076//PTHR11076:SF11 - DNA REPAIR POLYMERASE UMUC / TRANSFERASE FAMILY MEMBER // DNA POLYMERASE ETA; DNA polymerase eta subunit | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGTGAGAATCGGGGTGCGTTCCACATCAT |
Internal bar code: | TGCAAGTCCACCCGCGATATAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 234 |
LEAP-Seq percent confirming: | 42.0375 |
LEAP-Seq n confirming: | 2777 |
LEAP-Seq n nonconfirming: | 3829 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTAGTCGAACTGCCCTTTG |
Suggested primer 2: | CAACGCGCTATGAACTACGA |