| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.130127 |
| Chromosome: | chromosome 16 |
| Location: | 2202347 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g658526 | MNME1,TGD3,MNME | (1 of 1) K03977 - GTP-binding protein (engA); Putative ABC transport system ATP-binding protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCCCGTGGTTTGGCACCCCCTGTCTGACA |
| Internal bar code: | ATGCATTAGGGGACGGGGGTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 637 |
| LEAP-Seq percent confirming: | 98.6284 |
| LEAP-Seq n confirming: | 3092 |
| LEAP-Seq n nonconfirming: | 43 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACACGGTAATCCTGCTGGT |
| Suggested primer 2: | GGGGGAGGGGTTGTAGATAA |