| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.130172 |
| Chromosome: | chromosome 17 |
| Location: | 4202752 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g730200 | PEX7 | Peroxisomal targeting signal 2 receptor; (1 of 1) K13341 - peroxin-7 (PEX7, PTS2R) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGCAACCCGACCTGCCTCCGGCCCCTCAC |
| Internal bar code: | GAAGCGCGACGAACGTGGCGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 19 |
| LEAP-Seq percent confirming: | 52.282 |
| LEAP-Seq n confirming: | 1157 |
| LEAP-Seq n nonconfirming: | 1056 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCTGTGAAGGAGCGAAAGG |
| Suggested primer 2: | ACAGGTTGGAGTGTTGGGAG |