| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.130194 |
| Chromosome: | chromosome 4 |
| Location: | 3762934 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g229494 | (1 of 70) 3.1.3.16 - Protein-serine/threonine phosphatase / Serine/threonine specific protein phosphatase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCACTGCTGACAACGTCACGGTCATTGTCA |
| Internal bar code: | TTTATGCAGGGACTAACGTTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 570 |
| LEAP-Seq percent confirming: | 78.9405 |
| LEAP-Seq n confirming: | 23634 |
| LEAP-Seq n nonconfirming: | 6305 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAGATTCTCCACTTCTCCG |
| Suggested primer 2: | TGGGTTGTTGTGTTCACGTT |