| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.130366 |
| Chromosome: | chromosome 6 |
| Location: | 5217020 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g282000 | SSIII,STA3,SSS3A,SSS3 | (1 of 1) PF00534//PF08323//PF16760 - Glycosyl transferases group 1 (Glycos_transf_1) // Starch synthase catalytic domain (Glyco_transf_5) // Starch/carbohydrate-binding module (family 53) (CBM53); Soluble starch synthase III | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCTCCCACGGCCCGCCCTCCACACGCGCC |
| Internal bar code: | GGAATATGGTTGCAGATAACAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 693 |
| LEAP-Seq percent confirming: | 79.4958 |
| LEAP-Seq n confirming: | 473 |
| LEAP-Seq n nonconfirming: | 122 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACACATATGGCCTCGTGTC |
| Suggested primer 2: | AGGGGATTTGTTACTGCACG |