Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.130372 |
Chromosome: | chromosome 12 |
Location: | 2641771 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g504400 | (1 of 1) 2.3.1.22 - 2-acylglycerol O-acyltransferase / Monoglyceride acyltransferase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTATCCCCTCCCCTCCCTCCCTCCTCTCC |
Internal bar code: | GCACTCGTGTCCGGCCCATTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 17 |
LEAP-Seq percent confirming: | 94.4444 |
LEAP-Seq n confirming: | 34 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCTTGCAACAAATGCACACA |
Suggested primer 2: | AACCGTTGTTCGGATACAGG |